6th to 8th of July 2015

Hello world! I am Mustafa Orhan Canatan, one of two people who shall be writing the adventures of our group in English. The blog entries I shall write about shall consist of a general recap of the first 3 days of the week (Monday, Tuesday and Wednesday). The goal of these posts are to make the readers understand what we have been doing during our time in the bioinformatics course. So without further ado let's begin at the beginning of our first week.

6/7/2015

We started the day by tidying up our new home - aka the bioinformatics room - to look pretty nice and clean, as a home should. Mr. Ahmet mentioned we should spend our free time carefully and efficiently.

We then moved on to reading The Code Issue by Paul Ford published in the Bloomberg Businessweek on June 11 2015. The importance of this document is to understand computers and coding in general, and how they have become a mandatory part of anybody who wishes to keep up with the modern world.

We were also shown two games which we will utilize and compete against each other in teams. These games are Minecraft and Game Dev Tycoon. We saw what these games were capable of in a professional environment and what they can accomplish and teach us.

We briefly talked about how Python can supply 99% of our coding need. There is also a Django framework for Python to cover the missing features of Python. Otherwise Python on its own is known as a glue language -  a scripting language - that is not considered a real or full programming language by most programmers.

The overall goal of this camp is to understand and learn all manner of data science and the art of machine learning. We will accomplish this via the usage of several resources, the first of which is Data Science from Scratch by Joel Grus.

Next up we learned about our shared bioinformatics wiki and how to utilize it to take our daily notes and record them so others can see what we have been up to.

Next up Osman, Seyit and I spent a lot of time trying to get our educational Minecraft server to run with no luck. After a long time of tinkering with localhost, port opening, firewall settings and finding our internal ip addresses we had given up setting up a local server so we agreed to set up a server on a more powerful dedicated computer to see if that would help the situation.

7/7/2015

This was perhaps the first day that everyone entered our room and sat down to work as a whole on various projects that we were assigned. Mainly people were working on the Data Science from Scratch chapter presentation or the article generation on the various genetic tools that can be found online.

Our advances into trying to get Minecraft working continue with us trying to attach an extra modem to the system to bypass the firewall of the preceding modem by connecting directly to our modem without a firewall to connect locally. Eventually we managed to get a local server connected to a group members computer while connected to our new local router without an internet connection.

We then moved on to our Skype discussion with A.P. Emre Sümer. He talked about his entrance to the academic field. He started with graduating from genetics. Then he moved on to working in the drug industry after his education. Last year he also joined the bioinformatics course like us and highly enjoyed it. He told us that the job industry is not forgiving in his field and he had applied to over 150 jobs before finding a job. We should be patient when dealing with bioinformatics and genetics job offers. He highly recommended having a high level of English and the ability to learn subject matters quickly.

Then we talked and had a look at Scratch by MIT. We were tasked with making a game of catching an accelerating ball in some sort of contraption, or repeating until a ball was caught.

Chapter 1 of Data Science from Scratch Presentation:

Data is fundamental and prevalent in our lives. Data Science can be used to do a lot of things. Example given is a friends of friends function that shows the relationships between people and how two strange people are bridged by somebody else they both know. Other examples given were showing how experience in a job led to a higher salary and how to tidy up a list of interests by using some modules.

We also got a quick intro Trello and Slack and how we can organize our schedule and get alerts for projects being due soon.

8/7/2015

We started the day by testing out our Scratch program of our gravity simulated falling objects. Despite the target audience of Scratch being for kids, some of us were still having trouble with programming the gravity simulation. Some used increasing distance fallen every second, same distance fallen with shorter and shorter time, and others subtracted from the y-axis while the object falling did not touch another prop.

Then we got our first Python exercise which was to take the sequence  of CDKN2A (GGTTAAAACCGAAAATAAAAATGGGCTAGACACAAAGGACTCGGTGCTTGTCCCAGCCAGGCGCCCTCGGCGACGCGGGCAGCTGGGAGGGGAATGGGCGCCCGGACCCAGCTGGGACCCCCGGGTGCGACTCCACCTACCTAGTCCGGCGCCAGGCCGGGTCGACAGCTCCGGCAGCGC) and calculate how many of each of the 4 bases (A, T, C, G) along with their percentages are present in the given sequence. CDKN2A (cyclin-dependent kinase inhibitor 2A) codes p16 and p14arf, both of whom are tumor suppressors. CDKN2A is associated with melanoma and pancreatic cancer. The results of our study are as follows:

number of A bases is: 38

number of G bases is: 62

number of T bases is: 21

number of C bases is: 59

percentage of A is: 21.1111111111%

percentage of T is: 11.6666666667%

percentage of C is: 32.7777777778%

percentage of G is: 34.4444444444%

The second part of our coding was to simply divide the sequence into its basic components: codons. As it turned out it wasn’t too easy to achieve our goal but in the end we managed to conquer the coding.

We then got started on our Minecraft project which was to rebuild the Erciyes University in our own imaginative way. This was possible to the combined efforts of the class in getting the server running on a spare computer and messing around in the settings to configure the world to our need. Such modifications include changing the gamemode to creative, disabling mob spawn, disabling npc spawns, and setting up the ideal port and ip address. As it is our first building project it is a rather laid back and relaxing experience.

Then it was time to present chapter 2 of the Data Science from Scratch book. The chapter details the introduction to Python with Pythonic and non-Pythonic solutions, whitespace, most modules having to be imported, functions, multiline strings, lists, tuples, dictionaries, counters, sets, while, for, continue, break, Booleans, sorting, and randomization. This is not the complete list of everything in this chapter.

We resumed the third part of our coding with matching our codons to their respective proteins by using the handy DNA codon table:

amino_acids = {'TTT': 'F', 'TCT': 'S', 'TAT': 'Y', 'TGT': 'C',

            'TTC': 'F', 'TCC': 'S', 'TAC': 'Y', 'TGC': 'C',

            'TTA': 'L', 'TCA': 'S', 'TAA': '*', 'TGA': '*',

            'TTG': 'L', 'TCG': 'S', 'TAG': '*', 'TGG': 'W',

            'CTT': 'L', 'CCT': 'P', 'CAT': 'H', 'CGT': 'R',

            'CTC': 'L', 'CCC': 'P', 'CAC': 'H', 'CGC': 'R',

            'CTA': 'L', 'CCA': 'P', 'CAA': 'Q', 'CGA': 'R',

            'CTG': 'L', 'CCG': 'P', 'CAG': 'Q', 'CGG': 'R',

            'ATT': 'I', 'ACT': 'T', 'AAT': 'N', 'AGT': 'S',

            'ATC': 'I', 'ACC': 'T', 'AAC': 'N', 'AGC': 'S',

            'ATA': 'I', 'ACA': 'T', 'AAA': 'K', 'AGA': 'R',

            'ATG': 'M', 'ACG': 'T', 'AAG': 'K', 'AGG': 'R',

            'GTT': 'V', 'GCT': 'A', 'GAT': 'D', 'GGT': 'G',

            'GTC': 'V', 'GCC': 'A', 'GAC': 'D', 'GGC': 'G',

            'GTA': 'V', 'GCA': 'A', 'GAA': 'E', 'GGA': 'G',

            'GTG': 'V', 'GCG': 'A', 'GAG': 'E', 'GGG': 'G'

       }

We were then tasked to convert the result into a string, which we completed.

Next up on our agenda was our Skype talk with Evrim Fer. She is dealing with an evolution based internship with Neanderthals living in Europe and matching the Turkish population's genetic composition to different Neanderthal DNA and which parts of the country Neanderthals were more prevalent and how they spread out. They use R and Python for the data crunching that takes place in her work. She told us that apart from learning about programming in our bioinformatics camp she benefited from the blog writing and wiki note taking in her real life. She regrets not learning biostatistics better as it is now a mandatory part of her life. She also said the presentations she did helped with her social skills.

To finish off our day we worked on our articles due for tomorrow and put in an hour more on our Minecraft server, building our campus a bit more.